2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Suzuki-Miyaura cross-coupling of aryl and alkyl halides using palladium/imidazolium salt protocols

A simple new protocol for the high yielding Suzuki-Miyaura cross-couplings of aryl chlorides with aryl boronic acids using a palladium/imidazolium salt catalytic system is presented. The first examples of a palladium/imidazolium salt protocol for sp³-sp³ Suzuki-Miyaura couplings of alkyl halides are also disclosed.     

Stereoselective E/Z photoisomerization of oxazolidinone functionalized enecarbamates: direct and triplet sensitized irradiation

Oxazolidinone-functionalized enecarbamates undergo diastereoselective E/Z photoisomerization upon direct and triplet sensitized irradiations with chiral/achiral sensitizers, showing that the enhanced product diastereoselectivity depends on the solvent and temperature.     

Synthesis and capsule formation of upper rim substituted tetra-acrylamido calix[4]arenes

Upper rim substituted tetraiodo calix[4]arenes are coupled to a variety of acrylamides using the palladium catalysed Heck reaction. Tetra-acrylamido upper rim substituted calix[4]arenes are obtained in good yields with exceptionally high stereoselectivity, to produce the all-trans isomers. Tetra-acrylamido calix[4]arenes derived from secondary acrylamides are shown to dimerise via eight hydrogen bonds to form dimeric capsules, which are able to include small organic molecules.     

Determination of uranium after its selective extraction as phenylacetate

The method described is based on the extraction of uranium with a chloroform solution of phenylacetic acid from slightly acidic solution containing nitrilotriacetic acid, which masks all interfering metals. After stripping into very dilute hydrochloric acid, uranium is reduced with ascorbic acid and determined complexometrically. The method permits reliable determination of uranium in the presence of all quadri-, ter- and bivalent metals investigated, molybdenum(VI), tungsten(VI), and vanadium(V).     

Electrophilic acetylation and bromination reactions of benzo[b]naphtho[2,3-e][1,4]dioxin

The reactivity of benzo[b]naphtho[2,3-e][1,4]dioxin in the electrophilic aromatic substitution reactions has been studied. Friedel-Crafts acetylation resulted in the formation of three out of the possible five monoacetylated products, with the acetyl group located in positions 8 (major), 7 and 6 (minor) of the heterocycle. In the bromination reaction a higher selectivity was observed with the 6-bromo derivative found as the only monobrominated product and the 6,11-dibromo derivative found as the only polybrominated product. A ratio of unreacted heterocycle:6-bromo:6,11-dibromo derivatives in the bromination reaction has been found to depend strongly on the reaction conditions and on the heterocycle:bromine ratio.     

Pd/P(t-Bu)(3): a mild and general catalyst for Stille reactions of aryl chlorides and aryl bromides

Pd/P(t-Bu)(3) serves as an unusually reactive catalyst for Stille reactions of aryl chlorides and bromides, providing solutions to a number of long-standing challenges. An unprecedented array of aryl chlorides can be cross-coupled with a range of organotin reagents, including SnBu(4). Very hindered biaryls (e.g., tetra-ortho-substituted) can be synthesized, and aryl chlorides can be coupled in the presence of aryl triflates. The method is user-friendly, since a commercially available complex, Pd(P(t-Bu)(3))(2), is effective. Pd/P(t-Bu)(3) also functions as an active catalyst for Stille reactions of aryl bromides, furnishing the first general method for room-temperature cross-couplings.     

Determination of cadmium in mixtures with metal ions

A method for the determination of cadmium microamounts in mixtures with metallic ions withE _1/2 near toE _1/2 of cadmium is discussed. For higher selectivity cadmium was extracted in the form of the pyridin-thiocyanate complexes prior to polarography.

---

Bestimmung von Cadmium(II) neben anderen Metallionen

Zusammenfassung Es wird eine polarographische Methode zur Bestimmung von Cd(II) neben anderen Metallionen mitE _1/2 naheE _1/2(Cd) diskutiert. Zur Erhöhung der Selektivität und Genauigkeit wird eine Pyridin-Thiocyanat-Extraktion vorgeschalten.

     

Conformationally controlled (entropy effects), stereoselective vibrational quenching of singlet oxygen in the oxidative cleavage of oxazolidinone-functionalized enecarbamates through solvent and temperature variations

On photooxygenation (methylene blue as sensitizer) of E/Z enecarbamates, equipped with the oxazolidinone chiral auxiliary, the oxidative cleavage of the alkenyl functionality releases the enantiomerically enriched methyldesoxybenzoin (MDB) product. The extent (% ee) as well as the sense (R vs S) of the stereoselectivity in the MDB formation depends on the choice of the alkene configuration; the efficacy of stereocontrol may be tuned by appropriate solvent and temperature conditions. Highlighted is the finding that the formation of the preferred MDB enantiomer (R or S) depends for the E isomer on the chosen solvent and temperature, but not for the corresponding Z isomer. The activation parameters for the various solvents disclose that differential entropy effects (ΔΔS^‡) dominate the conformationally more flexible E diastereomers. As mechanistic rationale for this unprecedented conformationally imposed stereochemical behavior, we propose the competitive action of stereoselective vibrational quenching of the attacking singlet oxygen by the enecarbamate versus sterically controlled stereoselective oxidative cleavage of its double bond.     

Ortho effect in the mass spectrometric behaviour of N(pyrimidin-4-yl)aminobenzoic acids and their methyl esters

Ortho-. meta- and para-isomers of N-(pyrimidin-4-yl)aminobenzoic acid and their methyl esters were investigated by electron impact mass Spectrometry. Their fragmentation was found to be strongly dependent on the position of the substituent in the aminobenzoic moiety. Two different kinds of ortho effect were studied and confirmed with the aid of deuterium-labelled derivatives.